Sequence ID | >WENV181158513 |
Genome ID | OEIH01002045 |
Search identical group | |
Phylum/Class | [OEIH] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 75 |
End posion on genome | 2 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttttttatag |
tRNA gene sequence |
GACTTGGTAGCTCAGTTGGTAGAGCACAACACTTTTAATGTTGGGGTCCTGGGTTCGAGC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV181158513 Lys TTT g ACan nnnnnnnnnn G - C A - T C - G T + G T - A G - C G - C C G T G A C C C A T G A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |