Sequence ID | >WENV181159032 |
Genome ID | OEIH01032796 |
Search identical group | |
Phylum/Class | [OEIH] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 416 |
End posion on genome | 343 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tgcagcgcac |
tRNA gene sequence |
GCGCCTTTAGCTCAGCTGGAAGAGCAGCTGGTTTACACCCAGCAGGTCGGCGGTTCGAAC |
Downstream region at tRNA end position |
gatctgtgta |
Secondary structure (Cloverleaf model) | >WENV181159032 Val TAC c ACag gatctgtgta G - C C - G G - C C - G C - G T + G T - A C A T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C A A A AGGTC G - C C - G T - A G - C G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |