Sequence ID | >WENV181160474 |
Genome ID | OEIK01010221 |
Search identical group | |
Phylum/Class | [OEIK] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 573 |
End posion on genome | 497 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ccggatagaa |
tRNA gene sequence |
CTGCCCGTAGCTCAGCTGGATAGAGCATCAGCCTTCTAAGCTGAGGGTCACAGGTTCGAA |
Downstream region at tRNA end position |
gtagttgttt |
Secondary structure (Cloverleaf model) | >WENV181160474 Arg TCT a GCCA gtagttgttt C - G T - A G - C C - G C - G C - G G - C T A T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A A GGGTC T - A C - G A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |