Sequence ID | >WENV181160582 |
Genome ID | OEIK01014747 |
Search identical group | |
Phylum/Class | [OEIK] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 1611 |
End posion on genome | 1696 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
atagagtcac |
tRNA gene sequence |
GCGGTCGTGGCGGAATGGCAGACGCGCTAGCTTCAGGCGCTAGTGATGGCAACATCGTGG |
Downstream region at tRNA end position |
taagcacaga |
Secondary structure (Cloverleaf model) | >WENV181160582 Leu CAG c ACCA taagcacaga G - C C - G G - C G - C T - A C - G G - C T G T T C T C C A T A A G + | | | | A G G G C G G G A G G C G | | | T T C A C G C A G G TGATGGCAACATCGT C - G T - A A - T G - C C - G T C T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |