| Sequence ID | >WENV181164375 |
| Genome ID | OEIR01133236 |
| Phylum/Class | [OEIR] soil metagenome; soil |
| Species | |
| Start position on genome | 200 |
| End posion on genome | 274 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
tttaaaggat |
| tRNA gene sequence |
GGATCGGTAGTTCAGTTGGTTAGAATGCCGCCCTGTCACGGCGGAGGTCGCGGGTTCGAG |
| Downstream region at tRNA end position |
aaatagaact |
| Secondary structure (Cloverleaf model) | >WENV181164375 Asp GTC
t GCaa aaatagaact
G - C
G - C
A - T
T + G
C - G
G - C
G - C T G
T T G C C C A
T G A A + | | | | G
T C T T G G C G G G C
G | | | + T T
G G A A T
T T A G AGGTC
C - G
C - G
G - C
C - G
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |