Sequence ID | >WENV181165482 |
Genome ID | OEIS01006391 |
Search identical group | |
Phylum/Class | [OEIS] soil metagenome; soil |
Species | |
Start position on genome | 571 |
End posion on genome | 648 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cggcgtcggt |
tRNA gene sequence |
CGGAGCGTAGCGCAGCCCGGTTAGCGCACCAGTCTGGGGGACTGGGGGTCCCGAGTTCAA |
Downstream region at tRNA end position |
ataaaatcaa |
Secondary structure (Cloverleaf model) | >WENV181165482 Pro GGG t ACCA ataaaatcaa C - G G - C G - C A - T G - C C - G G - C T A T G G C T C A C C G A A | | | | | A C C G C G C C G A G C G | | | | T T G G C G C T T A A GGGTC C - G C - G A - T G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |