Sequence ID | >WENV181167344 |
Genome ID | OEIU01020657 |
Search identical group | |
Phylum/Class | [OEIU] activated sludge metagenome; Wastewater treatment plant of a petroleum refinery complex |
Species | |
Start position on genome | 1593 |
End posion on genome | 1517 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tcgttggtgc |
tRNA gene sequence |
GGGGTGGTAGTTAAGTTGGTTATAACGTCCGCCTGTCACGCGGAAGGCCGCGGGTTCGAG |
Downstream region at tRNA end position |
actttgatag |
Secondary structure (Cloverleaf model) | >WENV181167344 Asp GTC c GCCA actttgatag G - C G - C G - C G - C T - A G - C G - C T G T T G C C C A T G A A + | | | | G T A T T G G C G G G C G | | | | T T G T A A C T T A G AGGCC T - A C - G C - G G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |