Sequence ID | >WENV181179813 |
Genome ID | OEJT01019582 |
Search identical group | |
Phylum/Class | [OEJT] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 429 |
End posion on genome | 355 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tatctttttt |
tRNA gene sequence |
GCGGAAGTGGCTCAGTGGTAGAGCATCGCCTTGCCAAGGCGAGGGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
tttatgactt |
Secondary structure (Cloverleaf model) | >WENV181179813 Gly GCC t TCCA tttatgactt G - C C - G G - C G - C A - T A - T G - C T A T T G C C C A G A G + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC T - A C - G G - C C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |