Sequence ID | >WENV181181851 |
Genome ID | OEJV01000416 |
Search identical group | |
Phylum/Class | [OEJV] human metagenome; G_DNA_Supragingival plaque |
Species | |
Start position on genome | 11154 |
End posion on genome | 11078 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttcacttcac |
tRNA gene sequence |
GGCGAATTAGCTCAGTCGGTTAGAGCAGAGGAATCATAATCCTTGTGTCCGGGGTTCGAA |
Downstream region at tRNA end position |
aatttcgggg |
Secondary structure (Cloverleaf model) | >WENV181181851 Met CAT c ACCA aatttcgggg G - C G - C C - G G - C A - T A - T T - A T A T G T C C C A T G A A | + | | | G C C T C G C G G G G C G | | | | T T G G A G C T T A A GTGTC G + T A - T G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |