Sequence ID | >WENV181185332 |
Genome ID | OELI01001558 |
Search identical group | |
Phylum/Class | [OELI] metagenome; 1998 |
Species | |
Start position on genome | 4333 |
End posion on genome | 4259 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttttgtgtag |
tRNA gene sequence |
GCCCGCGTAGCTCAGTGGATTAGAGCGTTCGCCTCCGGAGCGAAAGGTCGCAGGTTCGAC |
Downstream region at tRNA end position |
atcaaaacga |
Secondary structure (Cloverleaf model) | >WENV181185332 Arg CCG g ACta atcaaaacga G + T C - G C - G C - G G - C C - G G - C C C T C G T C C A T G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T T A G AGGTC T - A T - A C - G G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |