Sequence ID | >WENV181197500 |
Genome ID | OERB01003891 |
Search identical group | |
Phylum/Class | [OERB] metagenome; Caecal content |
Species | |
Start position on genome | 551 |
End posion on genome | 476 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
caatttcacc |
tRNA gene sequence |
GGGGGTTTAGTTCAGCTGGTAGAACACTTGCTTTGCAAGCAAGGGGTCACCGGTTCGAGT |
Downstream region at tRNA end position |
agaatagatt |
Secondary structure (Cloverleaf model) | >WENV181197500 Ala TGC c ACCA agaatagatt G - C G - C G + T G - C G - C T - A T - A T G T T G G C C A C G A A | | | | | G T C T T G A C C G G C G | | | | T T G G A A C T A A GGGTC C - G T - A T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |