Sequence ID | >WENV181206127 |
Genome ID | OFAT01000005 |
Search identical group | |
Phylum/Class | [OFAT] metagenome; hydrothermal vent |
Species | |
Start position on genome | 6343 |
End posion on genome | 6419 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
taatgttggt |
tRNA gene sequence |
GCTGGTGTAGCTCAGTTGGCTAGAGCAGCTGATTTGTAATCAGCAGGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
tagaaatata |
Secondary structure (Cloverleaf model) | >WENV181206127 Thr TGT t TCCA tagaaatata G - C C - G T - A G - C G - C T - A G - C T G T T T C C C A T G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C C T A A AGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |