Sequence ID | >WENV181206244 |
Genome ID | OFAT01001276 |
Search identical group | |
Phylum/Class | [OFAT] metagenome; hydrothermal vent |
Species | |
Start position on genome | 149 |
End posion on genome | 63 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
taatcagtgT |
tRNA gene sequence |
GCAGGGGTTGTCGAGCCTGGCCAAAGACGCAGGACTTAGAATCCTGTCCTATAGTGGTTC |
Downstream region at tRNA end position |
ttcatttatt |
Secondary structure (Cloverleaf model) | >WENV181206244 Leu TAG T ATta ttcatttatt G - C C - G A - T G - C G - C G - C G - C T A T G T C C C A C C G A T | | | | | A T G C T G C A G G G C G | | | T T G A G A C C C A A G TCCTATAGTGGTTC C - G A - T G - C G - C A - T C A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |