Sequence ID | >WENV181206968 |
Genome ID | OFAX01007985 |
Search identical group | |
Phylum/Class | [OFAX] metagenome; hydrothermal vent |
Species | |
Start position on genome | 116 |
End posion on genome | 32 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
caacaaacat |
tRNA gene sequence |
GCGGGGATCGCCTAGCCTGGTAGGGCGTGGGATTGCTAATTCCATGTTCGCAAGAACACG |
Downstream region at tRNA end position |
ttttaattaa |
Secondary structure (Cloverleaf model) | >WENV181206968 Ser GCT t GCtt ttttaattaa G - C C - G G - C G - C G - C G - C A - T T A T C C C C C A C G A C | | | | | A C T C C G G G G G G C T + | | | T T G G G G C G T A G TGTTCGCAAGAACAC T - A G - C G - C G + T A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |