Sequence ID | >WENV181207464 |
Genome ID | OFAZ01000545 |
Search identical group | |
Phylum/Class | [OFAZ] metagenome; hydrothermal vent |
Species | |
Start position on genome | 3726 |
End posion on genome | 3801 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ttttaagggt |
tRNA gene sequence |
GTCCCCATCGTCTAGTGGCCCAGGACGCCGGCCTCTCACGCCGGTAACGGGGGTTCAAAT |
Downstream region at tRNA end position |
agaaagataa |
Secondary structure (Cloverleaf model) | >WENV181207464 Glu CTC t GCCA agaaagataa G - C T - A C - G C - G C - G C - G A - T T A T C C C C C A T G A C | | | | | A G T C T G G G G G G C G + | | | T T C G G A C C C A G TAAC C - G C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |