Sequence ID | >WENV181209325 |
Genome ID | OFBE01000200 |
Search identical group | |
Phylum/Class | [OFBE] metagenome; hydrothermal vent |
Species | |
Start position on genome | 4027 |
End posion on genome | 3955 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tccttcaaaa |
tRNA gene sequence |
GGGGGTGTAGCTCAGCTGGGAGAGCGCCTGCTTTGCAAGCAGGAGGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
tcgctctcct |
Secondary structure (Cloverleaf model) | >WENV181209325 Ala TGC a Atta tcgctctcct G - C G - C G + T G - C G - C T - A G - C T G T C A C C C A C G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |