Sequence ID | >WENV181210033 |
Genome ID | OFBG01001631 |
Search identical group | |
Phylum/Class | [OFBG] metagenome; hydrothermal vent |
Species | |
Start position on genome | 590 |
End posion on genome | 666 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gtacgcttat |
tRNA gene sequence |
GCGCTCGTAGCTCAGCTGGATAGAGTGTCGGCCTCCGAAGCCGAATGTCGGGTGTTCGAA |
Downstream region at tRNA end position |
ctttttttaa |
Secondary structure (Cloverleaf model) | >WENV181210033 Arg CCG t ACCA ctttttttaa G - C C - G G - C C - G T - A C - G G - C T A T T C C A C A C G A A + | | | | G T C T C G G G G T G C G | | | + T T G G A G T A T A G ATGTC T - A C - G G - C G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |