Sequence ID | >WENV181211479 |
Genome ID | OFBK01011467 |
Search identical group | |
Phylum/Class | [OFBK] metagenome; hydrothermal vent |
Species | |
Start position on genome | 511 |
End posion on genome | 587 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
tgaagcccgt |
tRNA gene sequence |
GCCCACGTGGCTCAGGAGGTTAGAGCGCACCCTTGGTAAGGGTGAGGTCGGCGGTTCAAC |
Downstream region at tRNA end position |
ctttctctat |
Secondary structure (Cloverleaf model) | >WENV181211479 Thr GGT t ACCA ctttctctat G - C C - G C - G C - G A - T C - G G - C T C T C C G C C A G G A G | | | | | A A C T C G G G C G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |