Sequence ID | >WENV181212423 |
Genome ID | OFBP01003517 |
Search identical group | |
Phylum/Class | [OFBP] metagenome; hydrothermal vent |
Species | |
Start position on genome | 325 |
End posion on genome | 397 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcaaacacat |
tRNA gene sequence |
GGCGGTGTAGCTCAGTGGTAGAGCAAACGACTCATAATCGTTGTGTCGAGAGTTCAATTC |
Downstream region at tRNA end position |
acctcaaacg |
Secondary structure (Cloverleaf model) | >WENV181212423 Met CAT t ACtc acctcaaacg G + T G - C C - G G - C G + T T - A G - C T T T C T C T C A G A A | | | | | A T C T C G G A G A G C G | | | | T T G G A G C T A A GTGTC A - T A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |