Sequence ID | >WENV181212889 |
Genome ID | OFBU01000764 |
Search identical group | |
Phylum/Class | [OFBU] metagenome; hydrothermal vent |
Species | |
Start position on genome | 3624 |
End posion on genome | 3550 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gggctgaaga |
tRNA gene sequence |
GGGCCCGTAGCTCAGTCTGGCAGAGCGCCTGGCTTTTAACCAGGTGGTCGAGGGTTCAAA |
Downstream region at tRNA end position |
tttccttggt |
Secondary structure (Cloverleaf model) | >WENV181212889 Lys TTT a GCta tttccttggt G - C G - C G - C C - G C - G C - G G - C T A T T T C C C A T G A A + | | | | A C C T C G G A G G G C T | | | | T T G G A G C G C A G TGGTC C - G C - G T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |