Sequence ID | >WENV181212897 |
Genome ID | OFBU01000854 |
Search identical group | |
Phylum/Class | [OFBU] metagenome; hydrothermal vent |
Species | |
Start position on genome | 172 |
End posion on genome | 245 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cccgaattga |
tRNA gene sequence |
GCGGAGTTAGTCCAGACTGGCAGGACGTCAGCTTCCCAAGCTGGAGGTCGCGTGTTCAAA |
Downstream region at tRNA end position |
ctcaaattaa |
Secondary structure (Cloverleaf model) | >WENV181212897 Gly CCC a Atac ctcaaattaa G - C C - G G - C G - C A - T G - C T - A T A T C G C C C A A G A A | | | | A C C C T G G C G T G C T | | | | T T G G G A C G C A G AGGTC T + G C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |