| Sequence ID | >WENV181214888 |
| Genome ID | OFBY01030663 |
| Phylum/Class | [OFBY] metagenome; hydrothermal vent |
| Species | |
| Start position on genome | 198 |
| End posion on genome | 123 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
gttattcatT |
| tRNA gene sequence |
GGGCCGGTCGTCTAGACTGGTAGGATACGCCCTTGGCATGGGTGAGATCGAGGGTTCAAA |
| Downstream region at tRNA end position |
atattttttg |
| Secondary structure (Cloverleaf model) | >WENV181214888 Ala GGC
T ATta atattttttg
G - C
G - C
G + T
C - G
C - G
G - C
G - C T A
T C T C C C A
A G A C | | | | | A
C T C T G G A G G G C
T + | | + T T
G G G A T
G T A A AGATC
C - G
G + T
C - G
C - G
C - G
T T
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |