Sequence ID | >WENV181214962 |
Genome ID | OFBZ01000269 |
Search identical group | |
Phylum/Class | [OFBZ] metagenome; hydrothermal vent |
Species | |
Start position on genome | 1343 |
End posion on genome | 1417 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tgaatattga |
tRNA gene sequence |
GGGCTGGTGATTTAGTGGTATAATGCCGCGTTCGCAACGCGGTTGTCAAGGGTTCAATTC |
Downstream region at tRNA end position |
cctagaaaac |
Secondary structure (Cloverleaf model) | >WENV181214962 Ala CGC a ACCA cctagaaaac G - C G - C G + T C - G T - A G - C G - C T T T T T C C C A G A G | | | | | A T T T T A A A G G G C G | | | T T G T A A T T A G TTGTC C - G C - G G - C C - G G - C T A T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |