Sequence ID | >WENV181215472 |
Genome ID | OFCA01000609 |
Search identical group | |
Phylum/Class | [OFCA] metagenome; hydrothermal vent |
Species | |
Start position on genome | 3196 |
End posion on genome | 3108 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
acgttttggt |
tRNA gene sequence |
GCGGAGGTAGCCAAGCCCGGCTACGGCGTGGGACTGGAGATCCCATGGGGCTTTGCCCCG |
Downstream region at tRNA end position |
cttcttttta |
Secondary structure (Cloverleaf model) | >WENV181215472 Ser GGA t GCCA cttcttttta G - C C - G G - C G - C A - T G - C G - C T A T C C C C C A C C G A A | | | | | A C A C C G G G G G G C G | | | T T G C G G C C T A G TGGGGCTTTGCCCCGC T - A G - C G - C G - C A - T C A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |