Sequence ID | >WENV181216673 |
Genome ID | OFCG01000029 |
Search identical group | |
Phylum/Class | [OFCG] metagenome; Human gut stool |
Species | |
Start position on genome | 70390 |
End posion on genome | 70463 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aaatgaattt |
tRNA gene sequence |
GGGGCTATGGCGCAGCTGGTAGCGCATCTCCATGGCATGGAGAGGGTCAGGGGTTCGAAT |
Downstream region at tRNA end position |
attgaaaccg |
Secondary structure (Cloverleaf model) | >WENV181216673 Ala GGC t ACag attgaaaccg G - C G - C G + T G - C C - G T - A A - T T A T T C C C C A C G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T A A GGGTC T - A C - G T - A C - G C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |