Sequence ID | >WENV181220631 |
Genome ID | OFCS01000001 |
Search identical group | |
Phylum/Class | [OFCS] metagenome; Human gut stool |
Species | |
Start position on genome | 13598 |
End posion on genome | 13683 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tgggcagcat |
tRNA gene sequence |
GGATGAATGTCCGAGCGGTCTAAGGAGCACGCCTCGAAAGCGTGTGAGGTGAAAGCCTCC |
Downstream region at tRNA end position |
ccaagccccc |
Secondary structure (Cloverleaf model) | >WENV181220631 Ser CGA t GCaa ccaagccccc G - C G - C A - T T - A G - C A - T A - T T A T C G C T C A C G A G | | | | | G G G C C T G C G A G C G | | | T T T A G G A C T A G TGAGGTGAAAGCCTCC C - G A - T C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |