Sequence ID | >WENV181222232 |
Genome ID | OFDA01000189 |
Search identical group | |
Phylum/Class | [OFDA] metagenome; Human gut stool |
Species | |
Start position on genome | 25892 |
End posion on genome | 25967 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ctttggatac |
tRNA gene sequence |
GGCCCCGTGGTGTAGCGGTTAACATGTCGCCCTGTCACGGCGAAGATCGTCAGTTCAAAT |
Downstream region at tRNA end position |
ttcatgcctc |
Secondary structure (Cloverleaf model) | >WENV181222232 Asp GTC c GCCA ttcatgcctc G - C G + T C - G C - G C - G C - G G - C T A T T A G T C A C G A G + | | | | A G T G T G G T C A G C G | | | + T T T A C A T T A G AGATC T - A C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |