Sequence ID | >WENV181224877 |
Genome ID | OFDG01012519 |
Search identical group | |
Phylum/Class | [OFDG] metagenome; hydrothermal vent |
Species | |
Start position on genome | 343 |
End posion on genome | 416 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gttggcactg |
tRNA gene sequence |
GGGCCGTTAACTCAGTTGGCAGAGTATCTGCCTTTTAAGCAGAGAGTCGCTGGTTCGAGC |
Downstream region at tRNA end position |
taaaagttat |
Secondary structure (Cloverleaf model) | >WENV181224877 Lys TTT g ACtt taaaagttat G - C G - C G - C C - G C - G G - C T - A C G T C G A C C A T G A A | | | | | G T C T C A G C T G G C G | | | | T T G G A G T C A A GAGTC T - A C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |