| Sequence ID | >WENV181225241 |
| Genome ID | OFDH01019269 |
| Phylum/Class | [OFDH] metagenome; hydrothermal vent |
| Species | |
| Start position on genome | 128 |
| End posion on genome | 204 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
actaagcaat |
| tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCATCTGGTTTGGGACCAGAGGGTCGCAGGTTCAAA |
| Downstream region at tRNA end position |
ttatttatga |
| Secondary structure (Cloverleaf model) | >WENV181225241 Pro TGG
t ACCA ttatttatga
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T C G T C C A
C G A A | | | | | A
C C G C G G C A G G C
T | | | | T T
G G C G C
G T A A GGGTC
T - A
C - G
T - A
G - C
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |