Sequence ID | >WENV181225285 |
Genome ID | OFDI01000023 |
Search identical group | |
Phylum/Class | [OFDI] metagenome; hydrothermal vent |
Species | |
Start position on genome | 7053 |
End posion on genome | 7128 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gtcaccactt |
tRNA gene sequence |
GGTCGCTTAGCTCAGTTGGTAGAGCGCTACCCTTACAAGGTAGATGTCACAAGTTCGAGT |
Downstream region at tRNA end position |
tctttatgac |
Secondary structure (Cloverleaf model) | >WENV181225285 Val TAC t ACCA tctttatgac G - C G - C T - A C - G G - C C - G T - A T G T T G T T C A T G A A | | | | | G T C T C G A C A A G C G | | | | T T G G A G C T A G ATGTC C - G T - A A - T C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |