Sequence ID | >WENV181226273 |
Genome ID | OFDK01000516 |
Search identical group | |
Phylum/Class | [OFDK] hot springs metagenome; Yellowstone National Park, Wyoming, USA |
Species | |
Start position on genome | 83 |
End posion on genome | 157 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
tttagctatt |
tRNA gene sequence |
GCTGGCGTAGCTCAGTGGCAGAGCAGTTGATTCGTAATCAACAGGTCGTGGGTTCGAATC |
Downstream region at tRNA end position |
gttcattaat |
Secondary structure (Cloverleaf model) | >WENV181226273 Thr CGT t TCCA gttcattaat G - C C - G T - A G - C G - C C - G G + T T A T C A C C C A G A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C C A A AGGTC G - C T - A T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |