Sequence ID | >WENV181230048 |
Genome ID | OFEK01000225 |
Search identical group | |
Phylum/Class | [OFEK] activated sludge metagenome; Anaerobic digester |
Species | |
Start position on genome | 7608 |
End posion on genome | 7693 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gaagttctat |
tRNA gene sequence |
GTTGAGGTAGCCAAGCCTGGTATGGCGCAGGTTTGCTAAACCTGTGTCCCCCTGGGACTC |
Downstream region at tRNA end position |
tcaccgacaa |
Secondary structure (Cloverleaf model) | >WENV181230048 Ser GCT t GCtt tcaccgacaa G - C T + G T - A G - C A - T G - C G - C T A T C T C C C A C G A A | | | | | A C A C C G G A G G G C T | | | | T T G T G G C G T A G TGTCCCCCTGGGACTC C - G A - T G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |