Sequence ID | >WENV181230532 |
Genome ID | OFEK01001403 |
Search identical group | |
Phylum/Class | [OFEK] activated sludge metagenome; Anaerobic digester |
Species | |
Start position on genome | 345 |
End posion on genome | 257 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gatgcacatT |
tRNA gene sequence |
GCTGAGGTAGTCTAGACCGGTAGGGCGCGGGCCTGGAAAGCCCGTGGGGCGTTGAGCCCC |
Downstream region at tRNA end position |
taaagcaagg |
Secondary structure (Cloverleaf model) | >WENV181230532 Ser GGA T GTtt taaagcaagg G - C C - G T - A G - C A - T G - C G - C T A T C C C T C A A G A A | | | | | A C T C T G G G G A G C C + | + | T T G G G G C G T A G TGGGGCGTTGAGCCCCTC C - G G - C G - C G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |