Sequence ID | >WENV181231278 |
Genome ID | OFEK01017430 |
Search identical group | |
Phylum/Class | [OFEK] activated sludge metagenome; Anaerobic digester |
Species | |
Start position on genome | 1551 |
End posion on genome | 1454 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tttcaggtac |
tRNA gene sequence |
GGAAGCGCGTCGGTCGCTGGTGGGCCGCCCGGTCTTCAAAACCGGTGTGGGGGGTGAGAA |
Downstream region at tRNA end position |
ttacatgttt |
Secondary structure (Cloverleaf model) | >WENV181231278 SeC TCA c GCCA ttacatgttt G - C G - C A - T A - T G - C C - G G - C C - G T T G T A C C C A C G C T + | | | | G T T G G C G T G G G C G + | | | T T G G C C G T G G C TGTGGGGGGTGAGAAACTTCCCGG C - G C - G G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |