Sequence ID | >WENV181231330 |
Genome ID | OFEK01020336 |
Search identical group | |
Phylum/Class | [OFEK] activated sludge metagenome; Anaerobic digester |
Species | |
Start position on genome | 1314 |
End posion on genome | 1238 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gttgaatatc |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCACTAGACTGGGGGTCTAGTGGTCGCTGGTTCGAA |
Downstream region at tRNA end position |
ataaaaacaa |
Secondary structure (Cloverleaf model) | >WENV181231330 Pro GGG c ACCA ataaaaacaa C - G G - C G - C G - C G - C C - G G - C T A T T G A C C A C G A A + | | | | G C C G C G G C T G G C T | | | | T T G G C G C G T A A TGGTC C - G T - A A - T G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |