Sequence ID | >WENV181231786 |
Genome ID | OFEK01065889 |
Search identical group | |
Phylum/Class | [OFEK] activated sludge metagenome; Anaerobic digester |
Species | |
Start position on genome | 332 |
End posion on genome | 406 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tagcacaaaT |
tRNA gene sequence |
GCGATAGTAGTCTAGCGGCAGGACAGGGGCTTCCCAAGCCTCTAACCCGGGTTCGATCCC |
Downstream region at tRNA end position |
ctgttttggt |
Secondary structure (Cloverleaf model) | >WENV181231786 Gly CCC T ATCC ctgttttggt G - C C - G G - C A - T T - A A - T G - C C T T G G C C C A G A A | | | | | G C T C T G C C G G G C G + | | | T T G G G A C C A A TAAC G - C G + T G - C G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |