Sequence ID | >WENV181232328 |
Genome ID | OFEN01000050 |
Search identical group | |
Phylum/Class | [OFEN] coral metagenome; NA |
Species | |
Start position on genome | 31054 |
End posion on genome | 30980 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
agtctttaat |
tRNA gene sequence |
CGGCGTATGGCGCAGCCTGGTAGCGCACTTCCTTGGGGTGGAAGGGGTCGTGGGTTCAAA |
Downstream region at tRNA end position |
catgttactt |
Secondary structure (Cloverleaf model) | >WENV181232328 Pro GGG t ACtc catgttactt C - G G - C G - C C - G G - C T - A A - T T A T C G C C C A C G A G | + | | | A C C G C G G T G G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A C - G C - G T T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |