Sequence ID | >WENV181234209 |
Genome ID | OFEU01000004 |
Search identical group | |
Phylum/Class | [OFEU] microbial mat metagenome; enrichment culture HLUCC-O from microbial mat sample; contains cyanobacterium Phormidium |
Species | |
Start position on genome | 557315 |
End posion on genome | 557229 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
actctccgat |
tRNA gene sequence |
GGCGGCGTGGTGAAATTGGTAGACACGACGGATTCAAAATCCGTTGGGGTAAAACCCGTG |
Downstream region at tRNA end position |
ttaacaagcc |
Secondary structure (Cloverleaf model) | >WENV181234209 Leu CAA t ACCA ttaacaagcc G + T G - C C - G G - C G - C C - G G - C T G T C C G C C A T A A G | | | | | G T A G T G G G C G G C G | | | T T G A C A C T A G G TGGGGTAAAACCCGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |