Sequence ID | >WENV181234322 |
Genome ID | OFEU01000037 |
Search identical group | |
Phylum/Class | [OFEU] microbial mat metagenome; enrichment culture HLUCC-O from microbial mat sample; contains cyanobacterium Phormidium |
Species | |
Start position on genome | 32884 |
End posion on genome | 32958 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
gccaccccag |
tRNA gene sequence |
GGGCCTGTAGCTCAGCGGTTAGAGCTGGCCGCTCATAACGGCTAGGTCGCGGGTTCGAAT |
Downstream region at tRNA end position |
ggtgcggcgg |
Secondary structure (Cloverleaf model) | >WENV181234322 Ile2 CAT g ACCg ggtgcggcgg G - C G - C G - C C - G C - G T + G G - C T A T C G T C C A C G A A | | + | | G G C T C G G C G G G C G | | | | T T T G A G C T A T AGGTC G + T G - C C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |