Sequence ID | >WENV181234341 |
Genome ID | OFEU01000046 |
Search identical group | |
Phylum/Class | [OFEU] microbial mat metagenome; enrichment culture HLUCC-O from microbial mat sample; contains cyanobacterium Phormidium |
Species | |
Start position on genome | 174960 |
End posion on genome | 174870 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aggcaagcgc |
tRNA gene sequence |
GGAGCAGTGGCCGAGTGGTCGAAGGCGCACGCCTGGAAAGTGTGTATACGGCAACCCCGT |
Downstream region at tRNA end position |
tcatcctcca |
Secondary structure (Cloverleaf model) | >WENV181234341 Ser GGA c GCCA tcatcctcca G - C G - C A - T G - C C - G A - T G - C T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATACGGCAACCCCGTATC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |