Sequence ID | >WENV181252729 |
Genome ID | OFFQ01000020 |
Search identical group | |
Phylum/Class | [OFFQ] mouse gut metagenome; faeces |
Species | |
Start position on genome | 68316 |
End posion on genome | 68242 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
ttctcgcgat |
tRNA gene sequence |
GCCACTGTAGCTCAGGGGTAGAGCAACGCATTCGTAATGCGTGGGTCGTCGGTTCAATTC |
Downstream region at tRNA end position |
tcttcatggg |
Secondary structure (Cloverleaf model) | >WENV181252729 Thr CGT t TCCA tcttcatggg G - C C - G C - G A - T C - G T - A G - C T T T C A G C C A G A A | | | | | A G C T C G G T C G G C G | | | | T T G G A G C T A A GGGTC A - T C - G G - C C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |