Sequence ID | >WENV181253057 |
Genome ID | OFFQ01000759 |
Search identical group | |
Phylum/Class | [OFFQ] mouse gut metagenome; faeces |
Species | |
Start position on genome | 21306 |
End posion on genome | 21383 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
accgattatc |
tRNA gene sequence |
GGGCGCTTAGCTCAGCTGGTTCAGAGCATCTGCCTTACAAGCAGAGGGTCGGGGGTTCGA |
Downstream region at tRNA end position |
aagaattttc |
Secondary structure (Cloverleaf model) | >WENV181253057 Val TAC c ACCA aagaattttc G - C G - C G - C C - G G - C C - G T - A T A T C T C C C A T C G A A | + | | | G G C T C G G G G G G C G | | | | T T T G A G C T C A A GGGTC T - A C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |