Sequence ID | >WENV181254869 |
Genome ID | OFFS01000002 |
Search identical group | |
Phylum/Class | [OFFS] mouse gut metagenome; faeces |
Species | |
Start position on genome | 367702 |
End posion on genome | 367778 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cttgggttat |
tRNA gene sequence |
GGCCCGTTCGTCTAGCGGTTCAGGACGCCGCCCTCTCAAGGCGGAGATCACCAGTTCGAA |
Downstream region at tRNA end position |
cgcttttcct |
Secondary structure (Cloverleaf model) | >WENV181254869 Glu CTC t ACCA cgcttttcct G + T G - C C - G C - G C - G G - C T - A T A T T G G T C A C G A C | | | | | G G T C T G A C C A G C G + | | | T T T G G A C T C A G AGATC C - G C - G G - C C - G C - G C A T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |