Sequence ID | >WENV181256832 |
Genome ID | OFFT01042287 |
Search identical group | |
Phylum/Class | [OFFT] mouse gut metagenome; faeces |
Species | |
Start position on genome | 615 |
End posion on genome | 521 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ccgttcttgt |
tRNA gene sequence |
GGAGAGGTAGCGAAGCTGGCCGTAACGCGCTCGACTCGAAATCGAGTTATCGGTTAATAG |
Downstream region at tRNA end position |
tttttgtgtc |
Secondary structure (Cloverleaf model) | >WENV181256832 Ser CGA t GCCA tttttgtgtc G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T C G A A | | | | | G G A G C G G T G G G C G | | | T T C A C G C C G T A G TTATCGGTTAATAGCCGGTAC C - G T - A C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |