Sequence ID | >WENV181263972 |
Genome ID | OFFZ01060039 |
Search identical group | |
Phylum/Class | [OFFZ] mouse gut metagenome; faeces |
Species | |
Start position on genome | 50 |
End posion on genome | 121 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
taaaagacat |
tRNA gene sequence |
GCAGACATAGTATATCGGTAGTACATCAGCTTCCCAAGCTGAGGAGGCGGGTTCGATTCC |
Downstream region at tRNA end position |
taaggtcctt |
Secondary structure (Cloverleaf model) | >WENV181263972 Gly CCC t TCta taaggtcctt G - C C - G A - T G - C A - T C - G A - T T T T T G C C C A T A A + | | | | G C T A T G G C G G G C G + | | | T T G G T A C T A A GGAG T - A C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |