Sequence ID | >WENV181267865 |
Genome ID | OFGD01000095 |
Search identical group | |
Phylum/Class | [OFGD] mouse gut metagenome; faeces |
Species | |
Start position on genome | 42250 |
End posion on genome | 42175 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tgcagcgaaT |
tRNA gene sequence |
GTGCGTTTAGCTCAGCTGGATAGAGCGTTTGGCTACGGACCAAAAGGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
cggaaaaggc |
Secondary structure (Cloverleaf model) | >WENV181267865 Arg ACG T GTtg cggaaaaggc G - C T - A G - C C - G G - C T - A T - A T A T T C T C C A C G A A + | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A G AGGTC T - A T - A T - A G - C G - C C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |