Sequence ID | >WENV181271723 |
Genome ID | OFGG01000181 |
Search identical group | |
Phylum/Class | [OFGG] mouse gut metagenome; faeces |
Species | |
Start position on genome | 45557 |
End posion on genome | 45472 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tttttcaaaa |
tRNA gene sequence |
GCCGCAGTGGCGGAACTGGCAGACGCCCGGGACTTAAAATCCCGTGGGTAGTGATACCCG |
Downstream region at tRNA end position |
ttatttgtgt |
Secondary structure (Cloverleaf model) | >WENV181271723 Leu TAA a Attt ttatttgtgt G - C C - G C - G G - C C - G A - T G - C T T T T G G C C A C A A G | | | | | G T G G C G A C C G G C G | | | T T G A C G C C A G C TGGGTAGTGATACCCGT C - G G - C G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |