Sequence ID | >WENV181279512 |
Genome ID | OFGN01000896 |
Search identical group | |
Phylum/Class | [OFGN] mouse gut metagenome; faeces |
Species | |
Start position on genome | 10676 |
End posion on genome | 10601 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cgcacattac |
tRNA gene sequence |
GTCACCATCGTCTATCCGGTTAGGACGGCGGCCTCTCACGTCGCTAAGAGGGGTTCAAAT |
Downstream region at tRNA end position |
gcgcacgcac |
Secondary structure (Cloverleaf model) | >WENV181279512 Glu CTC c GCCA gcgcacgcac G - C T - A C - G A - T C - G C - G A - T T A T T C C C C A C T A C | | | | | A C T C T G A G G G G C G + | | | T T G G G A C T T A G TAAG G - C C - G G - C G + T C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |