Sequence ID | >WENV181285337 |
Genome ID | OFGS01000004 |
Search identical group | |
Phylum/Class | [OFGS] hot springs metagenome; Water and soil |
Species | |
Start position on genome | 235184 |
End posion on genome | 235094 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
aactgacaaa |
tRNA gene sequence |
GGAGAGGTGGCCGAGGGGTCTAAGGCACACGCCTGGAGAGCGTGCGGTGGCCACAAACCA |
Downstream region at tRNA end position |
gattttcgaa |
Secondary structure (Cloverleaf model) | >WENV181285337 Ser GGA a GCCA gattttcgaa G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A G G A G | | | | | A G G C C G G T G G G C G | | | T T T A G G C C T A A CGGTGGCCACAAACCACCC C - G A - T C - G G - C C - G C A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |