Sequence ID | >WENV181285776 |
Genome ID | OFGT01015370 |
Search identical group | |
Phylum/Class | [OFGT] soil metagenome; Clay |
Species | |
Start position on genome | 115 |
End posion on genome | 40 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
agtcattgat |
tRNA gene sequence |
GGGCCTGTAGCTCAACGGTTAGAGCAGGGGACTCATAATCCCTTGGTTGGGGGTTCGAAT |
Downstream region at tRNA end position |
gattcgatgc |
Secondary structure (Cloverleaf model) | >WENV181285776 Ile2 CAT t ACCA gattcgatgc G - C G - C G - C C - G C - G T + G G - C T A T C T C C C A C A A A | + | | | G G C T C G G G G G G C G | | | | T T T G A G C T A A TGGTT G + T G - C G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |